Volume11,Number1(ene-jun2017)
ÓrganooficialdelaAsociaciónPeruanadeHelmintologíaeInvertebradosAfines(APHIA)
Lima-Perú
VersiónImpresa:ISSN2218-6425VersiónElectrónica:ISSN1995-1043
Auspiciado por:
ISSN Versión impresa 2218-6425 ISSN Versión Electrónica 1995-1043
Neotropical Helminthology, 2017, 11(1), jan-jun: 25-36.
ORIGINAL ARTICLE / ARTÍCULO ORIGINAL
MOLECULAR IDENTIFICATION AND MORPHOLOGICAL CHARACTERIZATION OF
ANISAKIS SPP. L3 LARVAE (NEMATODA: ANISAKIDAE) IN SCOMBER COLIAS GMELIN,
1789 (PERCIFORMES: SCOMBRIDAE) FROM NORTHERN ARGENTINA
IDENTIFICACIÓN MOLECULAR Y CARACTERIZACIÓN MORFOLÓGICA DE LARVAS L3
DE ANISAKIS SPP. (NEMATODA: ANISAKIDAE) EN SCOMBER COLIAS GMELIN, 1789
(PERCIFORMES: SCOMBRIDAE) DEL NORTE DE ARGENTINA
1Laboratório de Ictioparasitologia, Central de Laboratórios de Ciência e Tecnologia Ambiental,
Pró-reitoria de Pesquisa e Pós-graduação, Universidade do Sagrado Coração, Bauru, SP, Brazil, CEP: 17011-160.
2Instituto de Biociência de Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho” (UNESP), Botucatu, SP, Brazil.
3Laboratório de Anatomia Humana, Universidade do Sagrado Coração, Bauru, SP, Brazil.
4Faculdade de Ciências, Universidade Estadual Paulista “Júlio de Mesquita Filho” (UNESP), Bauru, SP, Brazil.
Corresponding autor: Vanessa D. Abdallah.
E-mail: vanessaabdallahusc@gmail.com
Phone number: 55 (14) 99653-7204 / 55 (14) 2107-7069
1 2 3
Thaissa Duarte Serrano ; Larissa Sbeghen Pelegrini ; Eder Tavares Santiago ;
4 4 1 1
Fernanda Dotti do Prado ; Fabio Porto-Foresti ; Rodney Kozlowisky de Azevedo & Vanessa Doro Abdallah
ABSTRACT
Keywords: chub mackerel – fish parasites – genetic identification – polymerase chain reaction – South America – zoonotic potential
We performed the molecular identification of nematode third-stage larvae parasites of Scomber colias Gmelin, 1789
collected on the northern coast of Argentina, and described the morphological and morphometric features of these
parasites. Internal organs and muscles of 31 S. colias specimens were analyzed. The larvae genetic identification was
performed by PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism) using
amplification of nuclear DNA fragment (ITS1, ITS2 and 5.8S) and cleavage with specific restriction enzymes
(HinfI, HhaI) for identification. For morphological and morphometric analysis, the specimens were observed in
trinocular microscopy and in scanning electron microscopy. About 369 nematodes were collected in 68% of the
analyzed fishes. All parasites were in the internal organs of the host. No larval forms were detected in the muscles.
The molecular characterization produced four different patterns: Anisakis pegreffii Campana-Rouget & Biocca,
1955; Anisakis typica (Diesing, 1860); a hybrid of Anisakis spp; and other larvae that showed no molecular patterns
for Anisakis (Karl Rudolphi, 1809). Morphological-morphometric differences between A. pegreffii and A. typica
larvae were observed. Except the larval tooth, all structures of A. pegreffii had much higher dimensions than those
found in A. typica. In addition, the posterior end of A. pegreffii tapered more gradually and a mucron accompanied
this tapering. In A. typica the posterior end is more robust and the mucron is very tapered. This is the first contribution
to molecular identification with morphological characterization of Anisakis spp. in S. colias from Argentina.
Neotropical Helminthology
25
INTRODUCTION
26
RESUMEN
Palabras clave: caballa – parásitos de los peces – identificación genética – reacción en cadena de la polimerasa –
América del Sur – potencial zoonótico
Se realizó la identificación molecular de larvas de nemátodos en el tercer estadío del Scomber colias
Gmelin, 1789 recogidos en la costa norte de Argentina, y la caracterización morfológica y morfométrica
de estos parásitos. Los órganos internos y los músculos de 31 muestras de S. colias fueron analizadas. La
identificación genética de larvas se realizó por PCR-RFLP (Polymerase Chain Reaction - Restriction
Fragment Length Polymorphism) mediante la amplificación de un fragmento de ADN nuclear (ITS1,
ITS2 y 5,8S) y el escote con enzimas de restricción específicas (HinfI, HhaI) para la identificación. Para el
análisis morfológico y morfométrico, los especímenes se observaron en el microscopio trinocular y en
microscopía electrónica de barrido. Alrededor de 369 nematodos fueron recolectados en el 68% de los
peces analizados. Todos los parásitos se encontraron en los órganos internos del huésped, y no se detectó
formas larvarias en los músculos. La identificación molecular produjo cuatro diferentes patrones Anisakis
pegreffii Campana-Rouget & Biocca, 1955; Anisakis typica (Diesing, 1860); un híbrido de Anisakis spp; y
otras larvas que no muestran patrones moleculares correspondientes a Anisakis. Se observaron diferencias
morfológicas y morfométricas entre las larvas de A. pegreffii y A. typica. Excepto el diente larvario, todas
las estructuras de A. pegreffii tenían dimensiones mucho mayores que los encontrados en A. typica.
Además, el extremo posterior de A. pegreffii se estrecha más lentamente y el mucrón acompaña esta
conicidad. En A. typica el extremo posterior es más robusto y el mucrón es muy afilado. Esta es la primera
contribución a la identificación molecular con la caracterización morfológica de Anisakis spp. en S. colias
de Argentina.
can occur through ingestion of raw fish meat or that
insufficiently treated by heat, salt or smoke,
containing the third stage larvae. In this case man
acts as an accidental host and the larvae do not
complete their development. These parasites may
penetrate the digestive tract of humans and invade
others organs causing a number of pathological
effects (Lymbery & Cheah, 2007).
However, it is possible that the ingested larvae do
not attach to the gastrointestinal mucosa and are
eliminated by vomit or faeces, which would
represent a case considered as asymptomatic (Acha
& Szifres, 2003). Thus, according to Germano &
Germano (1998), this may be a reason for the lack
of reported cases of human anisakiasis in many
Latin American countries, where there is a
progressive increase in the raw fish consumption,
raising the possibilities of anisakiasis becoming an
emerging zoonosis in the future.
The pathology caused by accidental ingestion by
eating raw or undercooked fish infested with
Anisakis spp. larvae causes allergic disorders,
mainly characterized by acute hives generalized
and swelling (angioedema) able to result in
Fish meat is the most required source of animal
protein worldwide and possesses a significant
market value (Sidonio et al., 2012), due to it being
one of the most important food animals for human
consumption, with great nutritional emphasis
relative to the quantity and quality of its protein, its
high digestibility, vitamins and minerals presence
and, especially, by being a source of essential fatty
acids like omega-3, which comprises the
eicosapentaenoic acid (EPA) and docosahexaenoic
acid (DHA) (Sartori & Amancio, 2012).With the
increased consumption of raw fish in America,
typical of oriental and the Andes region cuisine,
diseases previously unreported in humans have
started to emerge. The most common among these
diseases is anisakiasis, transmitted through
consumption of raw or undercooked fish. In South
America, Smith (1999) considers the species of the
g e n u s A n i s a k i s , C o n t r a c a e c u m a n d
Pseudoterranova as mainly responsible for these
infections. About 20000 cases of anisakiasis have
been registered worldwide, with over 90% of them
in Japan (Chai et al., 2005). Anisakiasis in humans
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
anaphylactic shock (López-Serrano et al., 2000).
Symptoms occur usually between four and 72 h
after ingestion of the parasitized fish. The
acquisition of only fresh fish and their rapid
evisceration can prevent larvae migration to the
host muscle, considered one of the ways to prevent
anisakiasis (Ventura et al., 2008). However,
ingestion of dead parasites in fishes after cooking
or those preserved may also cause an allergic
reaction (Audicana et al., 2002).
The larval stages of Anisakis species in general do
not have host-parasite specificity, and can be found
in a wide variety of teleost fishes and also pelagic,
benthic-pelagic and benthic crustaceans (Busch et
al., 2012). By using intermediate hosts of different
trophic levels and habitats within the marine food
chains, the Anisakis larvae become abundant in
virtually all bathymetric levels (Kuhn et al., 2013).
The natural presence of larvae in fish muscle is
characteristic of some anisakid species (as A.
simplex and P. decipiens), with recognized
zoonotic importance, but the presence of other
species of anisakid larvae in somatic musculature
may be a consequence of post-mortem migration or
during the freezing process (Lymbery & Cheah,
2007).
For any parasitological research and
epidemiological study to be carried out with the
parasites, the identification of the exact species that
occurs in a given geographical area is the first
parameter to be considered (Mattiucci et al., 2011).
Before the use of molecular techniques for
diagnosis, anisakid larvae identification had been
difficult because the species morphology is
virtually indistinguishable among congeners, often
leading to erroneous determinations (Klimpel &
Palm, 2011; Kuhn et al., 2013). The importance of
such information also relies on the costs that the
presence of anisakids implies for the fishery
industry, reducing both the quality and the market
value of the products (Timi et al., 2014).
The application of methods such as PCR-RFLP
(Polymerase Chain Reaction - Restriction
Fragment Length Polymorphism) to taxonomic
studies of Anisakis spp. have revealed nine
different species with different preferences for
hosts and zoogeographic regions (Klimpel et al.,
2004, 2008; Valentini et al., 2006; Mattiucci &
Nascetti, 2008). The determination of anisakids
based on genetic molecular markers provides
unambiguous identification tools for these
helminths with zoonotic potential and is thus an
essential requirement for proper epidemiological
research (Mattiucci & Nascetti, 2008).
Scomber colias Gmelin, 1789 (Scombridae),
commonly known as chub mackerel is an
important commercial fish species with a wide
distribution, covering the South and North Atlantic
and the Mediterranean Sea (Collette & Nauen,
1983). This species is a relevant diet component of
large pelagic fishes such as sharks, as well as
marine mammals (like dolphins and whales)
(Lockwood, 1988). This species was included in
the IUCN Red List of Threatened Species in 2011
and listed as Least Concern, although there are
indications of regional declines in some
populations (IUCN, 2011).
Based on the foregoing, the present study aimed to
perform molecular identification of Anisakis spp.
L3 larvae parasitizing S. colias collected on the
northern coast of Argentina, as well as characterize
morphological and morphometric traits of these
nematode species.
Samples collection
The 31 samples of S. colias from the northern coast
of Argentina were acquired at CEASA (Municipal
Market) of the city of Bauru, SP, from March to
June 2014. The fish were frozen and uneviscerated.
The specimens were taken to the Laboratório de
Ictioparasitologia of the Universidade do Sagrado
Coração, where they were examined for parasites.
The fish were eviscerated through an incision near
to the cloaca. The internal organs of the abdominal
cavity were examined. These organs were passed
through 75μm sieves and washed with water. The
organ walls and contents were analyzed with a
stereomicroscope looking for anisakid nematodes.
Musculature was examined through filleting
technique and inspection by transparency using a
negatoscope.
Neotropical Helminthology, 2017, 11(1), jan-jun Molecular identication of Anisakis spp. Larvae
MATERIALS AND METHODS
27
28
The nematodes found were measured for total
length and then sectioned into three parts: the
anterior and posterior regions were separated for
taxonomic study, fixed and preserved in ethanol
80% and subsequently clarified with Amann's
Lactophenol following the methodology of Eiras et
al. (2006) and the middle region was used for
molecular study and preserved in ethanol 100%.
Molecular and morphological analysis
The total genomic DNA of larvae collected was
extracted and purified according to the information
described in the commercial Wizard genomic DNA
purification kit (Promega). The larvae genetic
identification were made by PCR-RFLP through
amplification of nuclear DNA fragment (internal
transcribed spacer - ITS1, ITS2 - and ribosomal
subunit 5.8S) and subsequent cleavage with
specific enzymes for the identification of Anisakis
species (D'amelio et al., 2000).
The PCR amplification reaction was conducted
u s i n g t h e p r i m e r s f o r w a r d A ( 5 ´
GTCGAATTCGTAGGTGAACCTGCGGAAGG
ATCA 3´) and reverse B (5´ GCCGGA
TCCGAATCCTGGTTAGTTTCTTTTCCTCCG
CT 3´) with a total volume of 20 μl containing 200
μM of each dNTP (dATP, dTTP, dGTP and dCTP),
MgCl 2.0 mM, buffer Taq 1X (20 mM Tris-HCl,
2
pH 8.4 and 50 mM KCl), 0.5 units (U) of Taq
polymerase (Invitrogen), 0.4 μM of each primer
and 20-50 ng of genomic DNA. Amplification
cycles followed an initial denaturation program at
94°C for 5 min followed by 35 cycles of
denaturation at 94ºC for 30s, hybridization at 55°C
for 30s and extension at 72°C for 30s with a final
extension of 10 minutes at 72ºC (D'amelio et al.,
2000).
Two RFLP reactions were performed, one using the
restriction enzyme HinfI and another using the
enzyme HhaI. Both had a final volume of 15 μl
containing 7 μl of the PCR products, enzyme buffer
1X (100mM Tris-HCl, pH 7.9, 500mM NaCl,
100mM MgCl and 10mM DTT), BSA 0.1mg/ml
2
and 5 enzyme units (10U/ul) (Promega), and
incubated for 2 hours at 37ºC and for 20 minutes at
65ºC.
The PCR-RFLP products were applied to agarose
gel electrophoresis 1.5% stained with Nancy-520
(Sigma-Aldrich), using the molecular weight
marker ladder 1Kb (Invitrogen), visualized under
UV light and captured with a digital camera
(OLYMPUS, CAMEDIA, C-5060 5.1 Megapixel).
Individuals were identified as certain species
within the genus Anisakis when presenting
electrophoretic band sizes corresponding to the
species-specific pattern cleavage described by
D'amelio et al. (2000) to one or both RFLPs HinfI
and HhaI.
For the morphological analysis of individuals with
scanning electron microscopy (SEM), some
specimens were dehydrated through a graded
series of decreasing ethanol, from 70% to 50%, and
finally in 30% ethanol. The samples were dried in
hexamethyl disilazane, coated with gold and
examined in a FEI Quanta 200 scanning electron
microscope at the Centro de Microscopia
Eletrônica of Instituto de Biociências, UNESP,
Botucatu, SP. A trinocular microscope was used for
morphometric analysis (Nikon E200). Specimen
measurements were obtained by a computerized
image analysis system (Motic, Moticam 5.0MP).
Measurements are given in micrometers (μm) and
presented with the mean followed by the maximum
and minimum values in parentheses.
Among the 31 specimens of S. colias analyzed, 21
(67.7%) were infected by at least one species of
Nematoda. A total of 369 nematode specimens
were collected (about 12 parasites per fish
examined). The parasites were found in host
stomachs, intestines and gonads. There were no
parasites in the muscles of the analyzed fish. The
fish showed a mean standard length of 27.94 ±
1.86cm and mean weight of 390.59 ± 61.30g.
Genetic identification of L3 type larvae (third stage
larvae) by PCR-RFLP using the two HinfI and
HhaI restriction enzymes produced four different
patterns: 222 individuals were identified as
Anisakis pegreffii Campana-Rouget & Biocca,
1955, 66 as Anisakis typica (Diesing, 1860), 9 as a
possible hybrid of Anisakis spp; and 72 other larvae
did not amplify or showed no molecular patterns
for the genus Anisakis (Table 1).
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
RESULTS
N. of
individuals
Band Size -
RFLP (bp) Molecular
identity
HinfI
HhaI
222
370, 300, 250
550, 430 A. pegrefi
66
620, 350
320, 240, 180, 160 A. typica
9
620, 370, 300, 250
550, 430 hybrid genotype
72
variable band size or no
amplication
variable band size or no
amplication not identicated
29
Individuals identified as A. pegreffii showed 370,
300 and 250 bp (base pairs) after the restriction
enzyme HinfI, 550 and 430 bp after the enzyme
HhaI (Figures 1A and 1B). The bands
corresponding to A. typica were 620 and 350 bp
after the HinfI cleavage and 320, 240, 180 and 160
bp by the HhaI enzyme (Figures 1A and 1B). The
hybrid presents bands of both species, A. pegreffii
and A. typica, for RFLP with the enzyme HinfI with
bands 620, 370, 300 and 250 bp (Figure 2), while
for RFLP analysis with the enzyme HhaI bands
were 550 and 430 base pairs (Sample 18, Figures
2A and 2B). Individuals that were not identified
showed a band pattern not corresponding to any
Anisakis species for this marker (D'amelio et al.,
2000) or showed no amplification in the gel
(Figures 1 and 2).
Neotropical Helminthology, 2017, 11(1), jan-jun Nematodirus helvetianus in cattle
Table 1. Species identication based on PCR-RFLP patterns (bp = base pairs).
Table 2. Measurements of Anisakis spp. third stage larvae samples, Scomber colias parasites, collected in Argentina
(Anisakis pegrefi: n = 10; Anisakis typica: n = 7) (TL = total length, MW = maximum width, SD = standard
deviation).
Anisakis pegrefi Anisakis typica
Mean ± SD min-max Mean ± SD min-max
Parasite (TL) 19725.7 ± 2067.3 15509-22999.2 10243.3 ± 1211.4 9272.3-11951.2
Parasite (MW) 468.3 ± 95.9 332.1-590.5 244.9 ± 6.7 210.8-251.6
Larval tooth (TTL) 14.8 ± 3.5 10.5-21.5 16.2 ± 2.3 12.9-18.5
Esophagus (ETL) 2498.6 ± 927.4 1659.6-4541.3 1632.4 ± 173 1297.3-1789.6
Esophagus (EMW) 199 ± 48.5 132.4-282.6 113.5 ± 17.4 77.7-134.2
Ventricle (VTL) 1260.6 ± 606.3 606.9-2169.5 120.1 ± 5.8 114.9-129.9
Ventricle (VMW) 269.8 ± 66.7 180.6-403.5 90.5 ± 3.4 85.4-94.4
Gut (GTL) 15836.0 ± 2524.8 12425.6-19909.5 8594.1 ± 1077 7715-10110.8
Gut (GMW) 323.9 ± 62 233-434.5 173.2 ± 9.6 165-186.7
Nervous ring (RTL) 113 ± 29.2 58.6-140 39.4 ± 5.4 34-44.7
Nervous ring (RMW) 116.6 ± 13.8 95.4-142.9 83.5 ± 3.9 79.6-87.4
Mucron (MTL) 34.2 ±7.8 23.2-49.2 15.1 ± 3.8 10.0-19.0
ETL/VTL 2.2 ± 0.6 1.4-2.8 13.2 ± 1.7 11.0-15.0
TL/ETL 8.7 ± 2.9 4.7-12.7 6.8 ± 0.7 5.7-7.3
TL/VTL 19.4 ± 9.3 9.1-33.3 85.8 ± 12.2 78.7-104
30
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
After the molecular analysis, some morphological
and morphometric differences between the larvae
of A. pegreffii and A. typica were observed. Except
the larval tooth length, all other A. pegreffii
structures presented much larger dimensions than
those found in A. typica (Table 2; Figure 3A and
3C). Another more obvious difference is the
relationship between measurements of esophagus
and ventricle lengths and the parasite total length.
Anisakis typica larvae showed higher values of
ETL/VTL and TL/VTL than those found in A.
pegreffii, since the A. typica esophagus length can
be on average 13 times larger than the ventricle,
while in A. pegreffii we noted that the esophagus
length is twice as large as the ventricle (Table 2).
Regarding the external morphology, at the anterior
end of A. pegreffii it can be observed that the larval
tooth is much less pronounced than in A. typica and
the posterior end of A. pegreffii was more gently
tapered slowly and the mucron accompanies this
thinning while in A. typica the posterior end is more
robust (or less tapered) and the mucron is well
tapered (Figures 3 A-D).
Figure 1. Genetic identication of A. pegrefi (Lanes 1, 2, 3, 5, 7, 9-13) and A. typica (Lane 6) individuals through PCR-RFLP
using the restriction enzymes HinfI (A) and HhaI (B). M: molecular weight marker 1kb; bp: base pairs.
31
Neotropical Helminthology, 2017, 11(1), jan-jun Nematodirus helvetianus in cattle
Figure 2. Genetic identication of a hybrid individual (Lane 18, highlighted by white dashes) through PCR-RFLP using the
restriction enzymes HinfI (A) and HhaI (B). M: molecular weight marker 1kb; bp: base pairs.
Figure 3. Morphology of third-stage larvae of Anisakis spp. parasites of Scomber colias. Scanning electron microscopy (SEM).
A) Anisakis pegrefi, anterior; B) Anisakis pegrefi, posterior region highlighting the mucron; C) Anisakis typica, anterior; D)
Anisakis typica, posterior region with mucron.
32
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
Figure 4. Internal morphology of Anisakis typica parasite of Scomber colias. A) anterior region, highlighting the esophagus,
ventricle and nervous ring; B) posterior region. Scale: 10 mm.
Figure 5. Internal morphology of Anisakis pegrefi parasite of Scomber colias. A) anterior region, highlighting the esophagus,
ventricle and nervous ring; B) posterior region. Scale: 10 mm.
33
Neotropical Helminthology, 2017, 11(1), jan-jun Nematodirus helvetianus in cattle
nematodes and therefore been considered a very
important tool in taxonomic studies (Eisenback,
1985).
Anisakis pegreffii was the parasite with highest
incidence in this work, and this fact has been
observed in other studies with the same host as well
as in other marine fish species such as Engraulis
encrasicolus (Linnaeus, 1758), Micromesistius
poutassou (Risso, 1827) and Trachurus trachurus
(Linnaeus, 1758) (Costa et al., 2011; Mladineo et
al., 2012; Piras et al., 2014). Among the nine
Anisakis species described and genetically
characterized to date, two, A. simplex s. str. and A.
pegreffii, have been identified as major agents of
human anisakiasis, with very significant reports in
countries like Italy and Japan (Umehara et al.,
2007; Mattiucci et al., 2011).
Anisakis typica utilizes several species of aquatic
mammals of the Delphinidae, Phocoenidae and
Pontoporidae families as final hosts. This species is
distributed in temperate and tropical waters, and
their populations, even from remote locations,
apparently have low intraspecific genetic
homogeneity (Mattiucci et al., 2002), and this
pattern can also be observed in populations of A.
pegreffii, according to Mattiucci et al. (1997). Also
according to these same authors, this fact would
indicate high levels of gene flow in these
nematodes, which can be explained by the high
vagility of intermediate and definitive hosts
involved in their life cycles.
The hybridism among species belonging to the
genus Anisakis has already been reported in other
studies (Abollo et al., 2003; Kuhn et al., 2013). It is
possible that hybridization in Anisakis allows an
adaptation to particular environmental conditions
or may be a consequence of the presence of
incomplete barriers, enabling meetings among
species, but it could be a reflection of the radiation
within the genus Anisakis.
The four species belonging to the genus Scomber
are commonly infected by anisakids, especially by
members of the genus Anisakis. Scomber
australasicus has the highest variability of species
recorded (A. pegreffii, A. simplex s.s., A. typica, A.
paggiae, A. physeteris, A. brevispiculata and a
recombinant genotype), followed by S. japonicus
(A. pegreffii, A. simplex s.s., A. typica, A.
The present work is the first contribution to the
molecular identification with morphological and
morphometric characterization of Anisakis spp. in
S. colias captured on the north coast of Argentina.
All larvae found were located in the internal organs
of the hosts, and no larvae were detected in
muscles, although there are such records in the
literature (Cremonte & Sardella, 1997; Costa et al.,
2011; Molina-Fernandez et al., 2015).
It can be affirmed that the risk of anisakiasis is real
and must always be taken into consideration,
despite the few official records of this zoonotic
disease in Argentina (Menghi et al., 2011), possibly
as a consequence of its symptoms which can be
easily confused with various diseases. However, as
was observed in this work, the presence of Anisakis
mainly in the mesentery and viscera can limit its
zoonotic potential (Mattos et al., 2014).
Nevertheless, it is worthwhile to consider that
some specimens of S. colias analyzed showed high
intensity of parasitism by anisakids (up to 82
parasites/fish).
The lack of morphological differences among the
larval stages of anisakids can occur due to factors
such as similar selection pressures causing the
conservation of morphology; consequently, some
morphological characteristics have little or no
taxonomic value due to evolutionary co-adaptation
of these endoparasites in their stable habitat,
represented by their definitive hosts. In other
words, populations of parasites isolated in their
host diverged genetically but preserved
morphological characteristics, making it essential
to use molecular tools for the correct diagnosis of
these species (Mattiucci & Nascetti, 2008).
However, Murata et al. (2011) conducted a study of
morphological and molecular characterization of
Anisakis larvae and concluded that these larvae are
differentiated not only by genetic analysis, but also
by morphological characteristics present in the L3,
which corroborates the results obtained in this
present study, since the SEM assisted in the
description of the external morphology with
viewing important taxonomic structures for this
parasite group. This technique has helped in the
study of the external morphology of many
DISCUSSION
34
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
physeteris, A. ziphidarum and a recombinant
genotype), by S. colias (A. pegreffii, A. physeteris,
A. nascettii and A. typica), and S. scombrus (A.
pegreffii, A. simplex s.s. and A. physeteris) (Abollo
et al., 2001; Pontes et al., 2005; Costa et al., 2011;
Bak et al., 2014; Chen & Shih, 2015).
The results obtained in this study may assist health
authorities and veterinarians to better control the
parasite occurrence, from the fish production phase
to their marketing, thus decreasing the morbidity
and mortality rates in captivity, with improvement
in the fish quality for the consumer, and
prophylactically, to prevent the spread of zoonoses
transmitted by fish.
The authors would like to thank Juan T. Timi for the
review and considerations in the manuscript, Leila
Felipini and Ross Martin Thomas for editing the
English, and the Conselho Nacional de
Desenvolvimento Científico e Tecnológico
(CNPq) for supporting the student fellowship
(Process No. 126202/2014-1).
ACKNOWLEDGMENTS
Abollo, E, Paggi, L, Pascual, S & D'amelio S. 2003.
Occurrence of recombinant genotypes of
Anisakis simplex s.s. and Anisakis pegreffii
(Nematoda: Anisakidae) in an area of
sympatry. Infection, Genetics and
Evolution, vol. 3, pp. 175–181.
Acha, PN & Szyfres, B. 2003. Zoonosis y
Enfermedades Transmisibles Comunes al
Hombre y a los Animales. Vol. III
Parasitosis. Organización Panamericana de
la Salud, Publicación Científica y Técnica,
Washington.
Audicana, MT, Ansotegui, IJ, de Corres, LF &
Kennedy, MW. 2002. Anisakis simplex:
dangerous – dead and alive? Trends in
Parasitology, vol. 18, pp. 20-25.
Bak, TJ, Jeon, CH & Kim, JH. 2014. Occurrence of
anisakid nematode larvae in chub mackerel
(Scomber japonicus) caught off Korea.
BIBLIOGRAPHIC REFERENCES
International Journal of Food Microbiology,
vol. 191, pp. 149–156.
Busch, MW, Kuhn, T, Münster, J & Klimpel, S.
2012. Marine crustaceans as potential hosts
and vectors for metazoan parasites. In:
Mehlhorn, H. (ed.). Arthropods as Vectors
of Emerging Diseases. Parasitology
Researchs Monographs, Springer-Verlag
Berlin Heidelberg, Berlin.
Chai, JY, Murrell, KD & Lymbery, AJ. 2005. Fish-
borne parasitic zoonoses: Status and issues.
International Journal for Parasitology, vol.
35, pp.1233–1254.
Chen, HY & Shih, HH. 2015. Occurrence and
prevalence of fish-borne Anisakis larvae in
the spotted mackerel Scomber australasicus
from Taiwanese waters. Acta Tropica, vol.
145, pp. 61–67.
Collette, BB & Nauen, CE. 1983. Scombrids of the
world. FAO Fisheries Synopsis, vol. 125,
pp. 1-137.
Costa, G, Cavallero, S, D'amelio, S, Paggi, L,
Santamaria, MTG, Perera, CB, Santos, MJ
& Khadem, M. 2011. Helminth parasites of
the Atlantic chub mackerel, Scomber colias
Gmelin, 1789 from Canary Islands, Central
north Atlantic, with comments on their
relations with other Atlantic regions. Acta
Parasitologica, vol. 56, pp. 98–104.
Cremonte, F & Sardella, NH. 1997. The parasite
fauna of Scomber japonicus Houttuyn 1782
(Pisces: Scombridae) in two zones of the
Argentine Sea. Fisheries Research, vol. 31,
pp. 1–9.
D'amelio, S, Mathiopoulos, KD, Santos, CP,
Pugachev, ON, Webbd, SC & Paggi, L.
2000. Genetic markers in ribosomal DNA
for the identification of members of the
genus Anisakis (Nematoda: Ascaridoidea)
defined by polymerase chain reaction-
based restriction fragment length
polymorphism. International Journal for
Parasitology, vol. 30, pp. 223-226.
Eiras, JC, Takemoto, RM & Pavanelli, GC. 2006.
Métodos de estudo e técnicas laboratoriais
em parasitologia de peixes. Universidade
Estadual de Maringá, Maringá.
Eisenback, JD. 1985. Techniques for preparing
nem a todes for scan ning electron
microscopy. In: Barker, KR, Carter, CC &
Sasser, JN (eds.). An advanced treatise on
Meloidogyne, vol. 2. Methodology, North
35
Neotropical Helminthology, 2017, 11(1), jan-jun Nematodirus helvetianus in cattle
Carolina State University Department
Graphics, Raleigh.
Germano, PML & Germano, MIS. 1998.
Anisaquíase: Zoonose Parasitária
emergente no Brasil? Revista Higiene
Alimentar, vol. 12, pp. 26-35.
IUCN. 2011. Red list of threatened species.
International Union for Conservation of
Nature and Natural Resources, Switzerland,
consulted on January 12, 2017,
<www.iucnredlist.org/details/170357/0>.
Klimpel, S, Kellermanns, E & Palm, HW. 2008.
Th e rol e o f p ela gic sw arm fi sh
(Myctophidae: Teleostei) in the oceanic life
cycle of Anisakis sibling species at the Mid-
Atlanti c Ridge, Central A tlantic.
Parasitology Research, vol. 104, pp. 43–53.
Klimpel, S & Palm, HW. 2011. Anisakid nematode
(Ascaridoidea) life cycles and distribution:
increasing zoonotic potential in the time of
climate change? In: Mehlhorn, H. (ed.)
Progress in Parasitology. Parasitology
Researchs Monographs 2, Springer-Verlag
Berlin Heidelberg, Berlin.
Klimpel, S, Palm, HW, Rückert, S & Piatkowski,
U. 2004. The life cycle of Anisakis simplex
in the Norwegian Deep (northern North
Sea). Parasitology Research, vol. 94, pp.
1–9.
Kuhn, T, Hailer, F, Palm, HW & Klimpel, S. 2013.
Global assessment of molecularly identified
Anisakis Dujardin, 1845 (Nematoda:
Anisakidae) in their teleost intermediate
hosts. Folia Parasitologica, vol. 60,
pp.123–134.
Lockwood, SJ. 1988. The mackerel, its biology,
assessment and the management of a
fishery. Fishing News Books Ltd., England.
López-Serrano, MC, Gomez, AA, Daschner, A,
Morenoancillo, A, De Parga, JMS,
Caballero, MT, Barranco, P & Cabañas, R.
2000. Gastroallergic anisakis: Findings in
22 patients. Journal of Gastroenterology
and Hepatology, vol. 15, pp. 503-506.
Lymbery, AJ & Cheah, FY. 2007. Anisakid
nematodes and anisakiasis. In: Murrell, KD
& Fried B. (eds.). Food-Borne parasitic
zoonoses: fish and Plant-Borne parasites.
World Class Parasites, Springer, New York.
pp. 185-207.
Mattiucci, S & Nascetti, G. 2008. Advances and
trends in the molecular systematics of
anisakid nematodes, with implications for
their evolutionary ecology and host-
parasite co-evolutionary processes.
Advances in Parasitology, vol. 66, pp.
47–148.
Mattiucci, S, Nascetti, G, Cianchi, R, Paggi, L,
Arduino, P, Margolis, L, Brattey, J, Webb,
SC, D'amelio, S, Orecchia, P & Bullini, L.
1997. Genetic and ecological data on the
Anisakis simplex complex with evidence for
a new species (Nematoda, Ascaridoidea,
Anisakidae). Journal of Parasitology, vol.
83, pp. 401–416.
Mattiucci, S, Paggi, L, Nascetti, G, Santos, CP,
Costa, G, Di Benedetto, AP, Ramos, R,
Argyrou, M, Cianchi, R & Bullini, L. 2002.
Genetic markers in the study of Anisakis
typica ( D i e s i n g , 1 8 6 0 ) : L a r v a l
identification and genetic relationships with
other species of Anisakis Dujardin, 1845
(Nematoda: Anisakidae). Systematic
Parasitology, vol. 51, pp. 159–170.
Mattiucci, S, Paoletti, M, Borrini, F, Palumbo, M,
Palmieri, RM, Gomes, V, Casati, A &
Nascetti, G. 2011. First molecular
identification of the zoonotic parasite
Anisakis pegreffii (Nematoda: Anisakidae)
in a paraffin-embedded granuloma taken
from a case of human intestinal anisakiasis
in Italy. BMC Infectious Diseases, vol. 11,
pp. 1-6.
Mattos, DPBG, Lopes, LMS, Verícimo, MA,
Alvares, TS & São Clemente, SC. 2014.
Anisakidae infection in five commercially
important fish species from the State of Rio
de Janeiro, Brazil. Revista Brasileira de
Medicina Veterinária, vol. 36, pp. 375-379.
Menghi, CI, Comunale, E & Gatta, CL. 2011.
Anisakiosis: primer diagnóstico en Buenos
Aires, Argentina. Revista de la Sociedad
Venezolana de Microbiología, vol. 31, pp.
71-73.
Mladineo, I, Simat, V, Miletić, J, Beck, R & Poljak,
V. 2012. Molecular identification and
population dynamic of Anisakis pegreffii
(Nematoda: Anisakidae Dujardin, 1845)
isolated from the European anchovy
(Engraulis encrasicolus L.) in the Adriatic
Sea. International Journal of Food
Microbiology, vol. 157, pp. 224-229.
Molina-Fernández, D, Gómez-Mateos, M,
Benítez, R, Martín-Sánchez, J & Adroher,
36
Neotropical Helminthology, 2017, 11(1), jan-jun Duarte Serrano et al.
FJ. 2015. Fishing area and fish size as risk
factors of Anisakis infection in sardines
(Sardina pilchardus) from Iberian waters,
southwestern Europe. International Journal
of Food Microbiology, vol. 203, pp. 27-34.
Murata, R, Suzuki, J, Sadamasu, K & Kai, A. 2011.
M o r p h o l o g i c a l a n d m o l e c u l a r
characterization of Anisakis larvae
(Nematoda: Anisakidae) in Beryx
splendens from Japanese w aters.
Parasitology International, vol. 60, pp. 193-
198.
Piras, MC, Tedde, T, Garippa, G, Virgilio, S, Sanna,
D, Farjallah, S & Merella, P. 2014.
Molecular and epidemiological data on
Anisakis spp. (Nematoda: Anisakidae) in
commercial fish caught off northern
Sardinia (western Mediterranean Sea).
Veterinary Parasitology, vol. 203, pp. 237-
240.
Pontes, T, D'amelio, S, Costa, G & Paggi, L. 2005.
Molecular characterization of larval
anisakid nematodes from marine fishes of
Madeira by a PCR-based approach, with
evidence for a new species. Journal of
Parasitology, vol. 91, pp. 1430–1434.
Sartori, AGO & Amancio, RD. 2012. Pescado:
importância nutricional e consumo no
Brasil. Segurança Alimentar e Nutricional,
vol. 19, pp. 83-93.
Sidonio, L, Cavalcanti, I, Capanema, L, Morch, R,
Magalhães, G, Lima, J, Burns, V, Alves Jr,
AJ & Mungioli, R. 2012. Panorama da
aquicultura no Brasil: desafios e
oportunidades. BNDES Setorial –
Agroindústria, vol. 35, pp. 421-463.
Smith, JW. 1999. Ascaridoid nematodes and
pathology of the alimentary tract and its
associated organs in vertebrates, including
man: a literature review. Helminthology
Abstracts, vol. 68, pp. 49-96.
Timi, JT, Paoletti, M, Cimmaruta, R, Lanfranchi,
AL, Alarcos, AJ, Garbin, L, Nascimento,
MG, Rodríguez, DH, Giardino, GV &
M a t t i u c c i , S . 2 0 1 4 . M o l e c u l a r
i d e n t i f i c a t i o n , m o r p h o l o g i c a l
characterization and new insights into the
ecology of larval Pseudoterranova cattani in
fishes from the Argentine coast with its
differentiation from the Antarctic species, P.
decipiens sp. E (Nematoda: Anisakidae).
Veterinary Parasitology, vol. 199, pp. 59-72.
Umehara, A, Kawakami, Y, Araki, J & Uchida, A.
2007. Molecular identification of the
etiological agent of the human anisakiasis
in Japan. Parasitology International, vol.
56, pp. 211-215.
Valentini, A, Mattiucci, S, Bondanelli, P, Webb,
SC, Mignucci-Giannone, A, Colomllavina,
MM & Nascetti, G. 2006. Genetic
relationships among Anisakis species
(Nematoda: Anisakidae) inferred from
mitochondrial cox2 sequences, and
comparison with allozyme data. Journal of
Parasitology, vol. 92, pp. 156–166.
Ventura, MT, Tummolo, RA, Leo, E, D'erasmo, M
& Arsieni, A. 2008. Immediate and cell-
mediated reactions in parasitic infections
by Anisakis simplex. Journal of
Investigational Allergology and Clinical
Immunology, vol. 18, pp. 253-259.
Received October 31, 2016.
Accepted January 12, 2017.
